| Title: | Identificação e quantificação de fungos em queijo colonial utilizando a região ITS1 do gene ITS |
| Author: | Freitas Cardoso, Mariana |
| Abstract: |
O queijo artesanal colonial é um dos produtos típicos da região sul do Brasil muito apreciado inclusive por turistas, e é definido como aquele obtido pela coagulação do leite bovino por meio do coalho e/ou outras enzimas coagulantes. Sabe-se que este tipo de alimento abriga uma complexa comunidade microbiana. Por isso, este trabalho teve por objetivo avaliar a microbiota fúngica presente em queijos artesanais, através do uso de sequenciamento genético das populações presentes no alimento. Para a identificação de bolores e leveduras a amplificação foi gerada com primers para a região ITS1, primer ITS1 (GAACCWGCGGARGGATCA) e primer ITS2 (GCTGCGTTCTTCATCGATGC). O equipamento utilizado para sequenciar as bibliotecas foi o MiSeq Sequencing System (Illumina Inc., USA) e o kit V2, com 300 ciclos e sequenciamento single-end. As análises das sequências foram realizadas por meio do pipeline Sentinel. Foram identificadas um total de 19 espécies de leveduras, sendo Diutina catenulata, Clavispora lusitaniae, Kodamaea ohmeri, Kluyveromyces marxianus e Candida ethanolica as que apresentaram maior número de reads na amostra de queijo colonial. Uma vez que o queijo representa um ambiente propício para o crescimento de microrganismos, a presença de leveduras não é inesperada. As atividades lipolítica e proteolítica destes microrganismos contribuem para formação de produtos diretamente ligados ao aroma, sabor e textura do queijo. Colonial artisanal cheese is one of the typical products of the southern region of Brazil, much appreciated even with tourists, and is defined as that obtained by coagulating bovine milk using rennet and / or other coagulating enzymes. It is known that this type of food is home to a complex microbial community. Therefore, this work aimed to evaluate the microbiota present in artisanal cheeses through the use of genetic sequencing of the populations present in the food. For the identification of molds and yeasts, amplification was generated with primers for the ITS1 region, ITS1 primer (GAACCWGCGGARGGATCA) and ITS2 primer (GCTGCGTTCTTCATCGATGC). The equipment used to sequence the libraries was the MiSeq Sequencing System (Illumina Inc., USA) and the V2 kit, with 300 cycles and single-end sequencing. Sequence analyzes were performed using the Sentinel pipeline. A total of 19 yeast species were identified, being Diutina catenulata, Clavispora lusitaniae, Kodamaea ohmeri, Kluyveromyces marxianus and Candida ethanolica those that obtained the highest number of reads. Since cheese represents an environment conducive to the growth of microorganisms, the presence of yeasts is not unexpected. The lipolytic and proteolytic activities of these microorganisms contribute to the formation of products directly linked to the aroma, flavor and texture of the cheese. |
| Description: | TCC (graduação) - Universidade Federal de Santa Catarina. Centro de Ciências Agrárias. Ciência e Tecnologia de Alimentos. |
| URI: | https://repositorio.ufsc.br/handle/123456789/223798 |
| Date: | 2021-05-04 |
| Files | Size | Format | View | Description |
|---|---|---|---|---|
| Ata_de_Defesa.pdf | 251.7Kb |
View/ |
Embargo | |
| TCC..pdf | 751.7Kb |
View/ |
TCC |