Identificação de fungos em linhaça ( Linum usitatissimum ) utilizando as regiões ITS1 e ITS2 do gene ITS

DSpace Repository

A- A A+

Identificação de fungos em linhaça ( Linum usitatissimum ) utilizando as regiões ITS1 e ITS2 do gene ITS

Show simple item record

dc.contributor Universidade Federal de Santa Catarina pt_BR
dc.contributor.advisor Verruck, Silvani
dc.contributor.author Rollemberg, Nathalia de Castro
dc.date.accessioned 2021-05-24T18:15:41Z
dc.date.available 2021-05-24T18:15:41Z
dc.date.issued 2021-05-04
dc.identifier.uri https://repositorio.ufsc.br/handle/123456789/223783
dc.description TCC (graduação) - Universidade Federal de Santa Catarina. Centro de Ciências Agrárias. Ciência e Tecnologia de Alimentos. pt_BR
dc.description.abstract A semente de linhaça (Linum usitatissimum L.) é conhecida por suas propriedades funcionais e presença de ácido α-linolênico (ômega-3). Contém ainda fibra solúvel e insolúvel, lignanas, ácidos fenólicos, flavonoides, ácido fítico, vitaminas e minerais. Todavia, a microbiota deste alimento pode ser foco de contaminação fúngica, interferindo na qualidade final. O objetivo deste trabalho foi identificar os fungos presentes em linhaça a granel através do gene ITS em uma abordagem metagenômica. A identificação fúngica foi realizada utilizando-se o sequenciamento de alto desempenho da região ITS1 usando os primers ITS1 (GAACCWGCGGARGGATCA) e ITS2 (GCTGCGTTCTTCATCGATGC) com 300 ciclos e sequenciamento single-end no equipamento MiSeq Sequencing System (Illumina Inc., USA). Foram encontrados seis gêneros e oito espécies de fungos na amostra de linhaça dourada analisada. O gênero Aspergillus se destacou com três espécies xerofílicas encontradas, A. cibarius, A. Appendiculatus e A. amstelodami. Aspergillus cibarius foi a mais abundante, porém não produz toxinas. O segundo gênero mais abundante foi Wallemia, com a espécie W. muriae. Este é um dos táxons de fungos com grande potencial xerofílico, sendo que algumas cepas podem produzir toxinas. A metagenômica revelou ser um método completo, rápido e eficiente, principalmente quando comparado a outros métodos como por exemplo, o de cultivo tradicional exercido em laboratório. O sequenciamento genético de alto desempenho é um importante aliado nas pesquisas, com o avanço tecnológico relacionado a segurança dos alimentos. pt_BR
dc.description.abstract Flaxseed (Linum usitatissimum L.) is known for its functional properties and presence of α linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins and minerals. However, the microbiota of this food can be the focus of fungal contamination, interfering with the final quality. The objective of this work was to identify the fungi present in bulk flaxseed through the ITS1 gene by using a metagenomics approach. Fungal identification was performed using the high performance sequencing of the ITS1 region using the ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., USA). Six genera and eight species of fungi were found in the golden linseed sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus and A. amstelodami. Aspergillus cibarius was the most abundant, but it does not produce toxins. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins (Walleminol and Walleminon). Metagenomics has proved to be a complete, fast and efficient method, especially when compared to other methods, such as traditional cultivation performed in the laboratory. High-performance genetic sequencing is an important ally in research, with technological advances related to food safety. pt_BR
dc.format.extent 46 f. pt_BR
dc.language.iso por pt_BR
dc.publisher Florianópolis, SC pt_BR
dc.rights Open Access
dc.subject Metagenômica pt_BR
dc.subject Genômica pt_BR
dc.subject Linhaça pt_BR
dc.subject Fungos pt_BR
dc.subject Sequenciamento genético de alto desempenho pt_BR
dc.title Identificação de fungos em linhaça ( Linum usitatissimum ) utilizando as regiões ITS1 e ITS2 do gene ITS pt_BR
dc.type TCCgrad pt_BR


Files in this item

Files Size Format View
TCC Nathalia.pdf 928.1Kb PDF View/Open
Ata de Defesa Nathalia.pdf 313.2Kb PDF View/Open

This item appears in the following Collection(s)

Show simple item record

Search DSpace


Browse

My Account

Statistics

Compartilhar